I have c-lightning running on my server and eclair mobile on my phone. I'm pretty satisfied with eclair mobile, you just have to realise it's a mobile wallet intended to PAY for services, it's not intended to receive payments (in the case you want to receive payments, c-lightning or lnd might be needed)

Well... It seems you can use the token to buy the application with a 50 percent discount... I'm not even sure if the tokens will cover the licence... The OP only tells us that he'll send tokens that can be used to purchase a licence and that you'll get a 50% discount, but if the licence costs $500, you'll still have to cough up more than $200 after the discount and the tokens have been applied (just an example here)...

But in case somebody is actually looking for such an app, and has an old, unused, freshly scratched android phone that doesn't have any financial info on it, and isn't connected to any of the social accounts you usually use and is installed with a blank google account (no cc info attached): why not... Good luck..

I don't really have time for a complete explanation (late for a meeting), but if you download the sourcecode of https://www.bitaddress.org/ from github, disconnect your pc from the internet, open the main page, go to wallet details and enter WIF + pass, you should get all other formats as output

Suggesting is a broad concept   But yes, i've published a walktrough, and offcourse the walktrough include steps to make a channel with my node (it does contain a part for longtime LN users telling them that if they already have opened channels, they can try if there's a route before opening a channel to me directly)... It wouldn't make sense to let a customer that's new to the LN make a connection to a different node and then hope there'll be a route between the node they made a channel to and mine... But that's actually my point: in theory, you are 100% correct, and your statements make more sense than mine, but in reality it's easyer to just spoonfeed your customer and let them make a channel with your node directly to cut back on support calls... This also saves on routing fees (eventough they are really small)

As for the remark that my node it well connected:

That's true... But in reality, if a store tells their customers to just create 1 channel to 1 node and fund it, they'll have to offer support if a route does not exist... They'll have a customer standing in front of their cash register trying to scan a QR code and getting an error message telling them (and the clerck) nothing at all...  If a store just tells their customers to open a channel directly to their node, it would cut back on support questions immensely.

But, once again, in theory, you are 100% correct and if everything works and grows as expected, my version of the facts might be a tad to complex.

I'm running a LN for many months now, and i've accepted over 70 LN payments (not an impressive number, i know), but all of the payments came from customers that opened a direct channel between their client and my node...

Actually, i've been testing and accepting LN payments on my demo site for quite a while already...
I personally find eclair mobile pretty user friendly. Offcourse, there's still a learning curve that's far bigger if you compare it with visa. Afterall, everybody has seen their grandparents, parents,... using VISA since they were born, so the visa-learning curve started allmost at birth. This offcourse isn't the case with BTC/LN.

Basically, you have to incentivise your clients to:

• 1) Install a decent desktop wallet on their pc
• 2) fund their desktop wallet with a couple hundred bucks worth of BTC
• 3) install a LN client on their mobile phone, create a new address, fund the address with "spending money"
• 4) open a channel between the client and the store's node, fund it

After these 4 steps, a store can generate a lightning invoice (QR) and let the customer scan and pay straight away... Works flawlessly, but still, i don't see my mother performing these steps...
Also, the fact that you'd have to close the current channel if you wish to open a new one (when you have insufficient funds in your current channel for planned expenses) is a drawback.

You can actually skip step 1, and switch step 2 and 3 (create a LN wallet right away, create a deposit addy and fund it straight from the exchange), but i would discourage anybody to keep a lot of funds on a mobile wallet.

The biggest "drawbacks" would probably be to get somebody to visit an exchange or some other seller to exchange FIAT to BTC...

At this moment, there are 2 options:

Option A: You are legit and just posted your wallet file, seed phrase and password on a PUBLIC forum... If you don't take it down immediately you'll get robbed in a heartbeat (if it's not already to late)

Option B: you are trying to get people to download an infected file so you can rob them yourself

I like neither of these options tough... If you're legit, take the link down immediately, search a trusted member and PM him/her the seed phrase (not in a rar or a zip), you can use pgp encryption if you don't want to PM sensitive data (but since you were perfectly happy posting said data on a public forum... does it even matter anymore?)

13 words sounds like a valid seed phrase including an extention word... You can always look at this wordlist: https://github.com/spesmilo/electrum/blob/master/electrum/wordlist/english.txt and see if the words are spelled correctly

With "key sentence thingy", do you by any chance mean the seed phrase? How many words?
If it's a valid seed phrase, you no longer need to worry about opening a wallet.dat, you can just open electrum and restore your wallet from the seed phrase... You'll only lose some metadata (like labels you added to addresses/transactions)

As for your second question: if you're looking for payed help, look for somebody with green trust (green numbers under their name, or if they're not visible: click on their username and look for the trust paragraph in their profile page), look at their trustpage and only after that, decide wither or not you want to send a walletfile containing the private keys to spend over $500... I've seen people getting scammed over a much smaller amount!

Well, there are mainly 2 types of help you can get here:

• paying help: in this case, make sure you pick a helper you can trust... It's not wise to send somebody a wallet.dat, but if you really can't figure this one out yourself, sometimes it's the only way
• free help: in this case you'll get some pointers from other members, but you'll have to recover the wallet yourself

Now, let's get things started: did you copy the wallet.dat onto at least 2 external devices (usbsticks for example?). You'll need a backup in case things go wrong!

Next step would be to identify the problem: Did you forget your password, are you 100% sure it's an electrum wallet, do you remember the version or the timeframe? Which error messages do you get? which steps did you already try?

The thing is, for as long as i can remember (not so long, i have a bad memory), electrum's default wallet was called default_wallet, wallet.dat is usually associated to bitcoin core... Now, it's possible older electrum versions did use wallet.dat as default wallet filename, or it's possible you have renamed the default wallet... But i just wonder if you're really 100% sure you're using the correct wallet here?

If the problem is using the wrong wallet, you can either install bitcoin core and see if core opens your wallet.dat, or you can use pyrecover... If the problem is a forgotten password, try out https://github.com/gurnec/btcrecover

So don't be supprised and say you weren't warned when your wallet gets drained some day...

Re-read the OP's post... He had some tokens (probably ERC20 tokens) that were sent to him but were not supported by his exodus wallet. Since he wanted to manipulate these tokens, he had to enter his seed phrase in a compatible wallet that did support these tokens. If he would have created a new seed phrase in coinomi he wouldn't have been able to manipulate the tokens that were sent to an address generated by his exodus wallet.

As for the second part of your question: there are 2048 words in the dictionary... A simple parser looking for a 12 or 24 words phrase consisting of solely words from this dictionary would suffice.

I used coinomi to keep some spending money, but i have moved everything but tBTC and tLTC from coinomi and i'll never use the application again, ever... It's not just the fact that they had a vulnerability, it's the way they behaved afterwards.

It's the new forum script that's being called "epochtalk", the forum name will probably remain bitcointalk.org. At the moment, bitcointalk.org uses the script "SMF", but the forum isn't called SMF either

You only need the seedphrase. You can copy the walletfile before upgrading, that way you have a backup in case your seedphrase is wrong. You can even restore the wallet on a different pc without touching the old version on your current pc.

About the old version: i've seen similar behaviour that was fixed with an upgrade.

https://www.blockchain.com/btc/tx/2e82e8505b7ba5a2bdbfc46f0573aa1f805e0cb990604c27ccc990506c52e041

Is the address generated by your wallet 198UaDzYw2BV7dRAEritf1WtsuiiiALEKa cause this address got funded with 0.0995 BTC, and this unspent output hasn't been spent yet.

Maybe you can start by ensuring you got an official electrum version. If you check the signature of your binary vs ThomasV's signature, you can ensure you didn't download a malware version (several malware versions have been floating around).

2.93 is old... Maybe update to the most recent version?

As long as you have the recovery seed written down somewhere, and the address that got funded was generated by an OFFICIAL electrum version, there should be a way to fix your problem by downloading the latest version from the official site, checking the signature and restoring your wallet with the seed phrase you wrote down during initialisation. Just make sure your pc is clean before you type in the seed phrase!

I've used bitgild several times in the past, perfect service

I've also used suissegold, but i wouldn't recommand them... Here's my review: http://www.mocacinno.com/blog/suissegold-precious-metal-dealer-review/

I've got the same sollution as Jet Cash, i can provide a free VPS to a GREEN trusted member for the sole purpose of testing out epochtalk (a new allocated ip costs me about $4 IIRC, but i'll carry that cost). I'll only provide one to a green trusted member tough, since i don't want to be abused (a VPS can be used for a lot more than simple epochtalk hosting if it falls into the wrong hands). I don't really have the time to get behind this problem right now, but if somebody has the trust, the qualifications and the time for some tests, i'd be more than willing to provide the resources (most popular linux distro's available, 1 or 2 Gb ram, 2-4 vCPU's, a couple gig's of diskspace... OpenVZ). I can even create a KVM VM if i have no other choice, but i'd prefer openVZ...

@mr3dds: no worries, i never implied anybody in this thread was stupid... It's actually a pretty good question, and i realise it's really hard to understand these numbers, even for a sharp mind.

I'm sorry to say, but that's not how biology works... AFAIK, your fingerprint is only partially influenced by your genetic markup. There are several genes that form the basic structure of your fingerprint, these genes also include the genes that determine the muscles, tendons, fatty tissue, bones,... of your fingers. The rest of your fingerprint is formed and influenced by in utero conditions (basically, the environment of the uterus while the embryo is growing).

This is also why identical twins don't have identical fingerprints.

In the very far future, one can theoretically assume that studying somebody's fingerprint might give you odds about the sequence of a very, very, very small part of the human genome... But it'll be more like:
There is a 20% chance that 7q14 is AGTAATCACTAATTAACGGTGAGGGTTTTAAGACGGATCTTTGCAAATTC
There is a 20% chance that 7q14 is AGCAAGCACTAATTAACGGTGAGGGTTTTAAGACGGATCTTTGCAAATTC
There is a 15% chance that 7q14 is AGAAAACACTAATTAACGGTGAGGGTTTTAAGACGGATCTTTGCAAATTC
...

But you'd still know nothing about 99,99% of the sequence because this sequence is codes proteins that have no influence on the fingerprint whatsoever

But saying that in the future we might be able to deduct somebody's genome by looking at his fingerprint is like saying we'll be able to construct the building plans of a house by looking at a random brick we found.

Disclaimer: I studied this stuff in college, which was 20 years ago... Things might have changed since then, and exept for random code generator everything else came from memory... It can be a little off.

Now, back on topic, the big problem with this thread is that human minds are not capable of understanding these big numbers... We see something like "the odds of a collision of a certain hash is 1 in 2^255", and we think: "well, with those odds, a collision is bound to happen sooner or later", but we don't realise the sheer size of this number. In reality, i'd say that altough one can calculate the odds of a collision, for all practical use you'd still be able to say the odds are practically 0.

In order to make such an attack work, you'd have to:

• Find a certain blockheight you want to manipulate
• Change the transactions in the block
• Generate a new block header, keep everything the same but different merkle root and nonce
• Start iterating trough the nonces and periodically chance some transaction data to create a new merkle root
• For each iteration, create the sha256d hash of this new header untill you find a combination whose hash is EXACTLY the same as the hash of the existing block (finding a hash that's simply under the target at that time wouldn't suffice, since the next block header included the hash of the block you're manipulating, so if the hash isn't exactly the same, the next block would simply be invalid in your chain

This is much harder than just standard brute-forcing.

And EVEN if you found a new header that, by some magic devine intervention had exactly the same hash as the existing block, how would you succeed in getting other nodes to accept your new block? You would be the only node with an alternative version, and your version would alter the utxo set... If you wanted this to work, your best chance would probably be to "change" one of the first of satoshi's blocks that did only contain the coinbase transaction AND where the output of the coinbase transaction was never spent (that way only one entry in the node's utxo set would dissapear, and a new one would pop up). If you "hacked" a block containing actual p2p transactions, you'd effectively destroy unspent outputs that were later used in other blocks, voiding a large part of the blockchain, which wouldn't work because of the checkpoints...

@lucius: Sure, i do feel for people making only a couple bucks each month... That being said: will those people be able to affort a device to surf with, internet access and power?
It seems to me that if you only make $8/month (Venezuela), you'll have to save ALL your earnings for several years to buy any device capable of surfing...

Even if the minimum wage in their country is sooo low, and by some miracle they succeed in buying a device, internet access and power, i'd still discourage them from airdrops (because they fill the forum with unneccesary bogus), cloud mining (because the scam factor) and social media (because there's a risk of them participating in a ponzi).

I do agree with you that my situation isn't the same as other people's situation, and i apologise if somebody from a low-wage country got offended by my post