Religion is a plague

[foggyb]

Actually, your DNA fucks up CONSTANTLY.

Our DNA replication is PERFECTLY coded. It is other forces and circumstances that corrupt the process. How many white blood cells out of 10 trillion daily do you suppose are "fucked up"?

I would wager its a very very small number, and most certainly not "constantly". If it were not, you would not survive for long, of that you can be assured.

Cancer results when ONE cell mutates. Then it copies itself. That's not a DNA replicator mistake. The replicator did its job, it makes copies, but the original was corrupted by some other factor, such as radiation.

[Rassah]

Actually, your DNA fucks up CONSTANTLY.

Our DNA replication is PERFECTLY coded. It is other forces and circumstances that corrupt the process.

Does it matter WHAT corrupts the process, as long as it is corrupt/changed? Not all corruptions end up being bad.

How many white blood cells out of 10 trillion daily do you suppose are "fucked up"?

I would wager its a very very small number, and most certainly not "constantly". If it were not, you would not survive for long, of that you can be assured.

Cancer results when ONE cell mutates. Then it copies itself. That's not a DNA replicator mistake. The replicator did its job, it makes copies, but the original was corrupted by some other factor, such as radiation.

Does it matter how many cells mutate? As long as one can, and does during reproduction, mutation is going on.

You obviously accept that genetic mutation happens, that members of the same species look different, that sex and reproduction happens... I'm sure you can accept that things like having a slightly better sense of taste, hearing, or smell happens... that some people are naturally more thin and muscle toned while others are more fat... That's pretty much all that's needed for evolution. As for the rest, your posts just make it seem as if you're REALLY trying hard to convince yourself otherwise.

[myrkul]

None of these examples are new added information!

Down's syndrome happens due to an added copy of a chromosome. Its not new data. Its redundant.
The other examples are not useful new data. Its corrupted garbage.

Dude, when you're dealing with 4 letters, there's not much you can do to make 'new' data...

catgggtaggctcagagtcggattcggattaagctagtcgattcgaagtcgcatgggtaggctcagagtcggattcgga ttaagctagtcgattcgaagtcg

catgggtaggctcagagtcggattcggattaagctagtcgattcgaagtcgcatggggattaagctagtcgattcgaag tcgcatgggtaggctcagagtcggattcggattaagctagtcgattcgaagtcg

There's new data in the second strand. Can you tell if I typed it in myself, or just duplicated another section?

[foggyb]

Well, first of all, entropy applies more to physics than evolution

I said entropy but i really meant disorder.

As for DNA, there's no self-replicating when you only have one half in the sperm and one half in the egg. If they join, and there are quirks, mutations, or some other changes, that's all that DNA has to start with. Nothing to correct from. Besides, if it was completely self correcting, we'd all look exactly the same. Ever notice how some people have bigger eyes than others, and some people have better sense of taste than others?

If the DNA isn't correct, you won't get a healthy baby. We don't look the same because the DNA for our looks and body type is unique to each of us, (except for identical twins) and yet, we're all still human, with the same feature set. There are 6 billion experiments of human DNA replication all over the globe, and none yet show signs of evolving into different species.

I would guess that platipy lived on land, and couldn't dive, instead using their beaks to snatch things out from under water.

Sounds like a good way to starve to death fast. Not really a land animal. Sucks at swimming. The platypus needs to eat about 20% of its own weight each day. This requires the platypus to spend an average of 12 hours each day looking for food.

Who says platypus had to start as an aquatic animal?

The scientific method tells you that all platypus are aquatic animals. Do you want to expand from there? Knock yourself out, but don't call it science.

....Eventually one of them was able to...
 a group came out......one of those nostril-closing freaks had..........The evolution of the electro-deception could easily have developed.........

Yup. Magic. There's no science here.

A little less magic than Zeus. I mean Ra. I mean Jesus.

You're right. Engineers are magicians.

[myrkul]

You're right. Engineers are magicians.

OK, he's just babbling, now, and we can ignore him like any other background noise. Go away, magic-zombie worshiping troll.

[evolve]

information certainly can be added during a mutation...

chromosomes may be added (such as in the case of down syndrome)
dna sequences may be added (over-replicate) or may be missing (dna insertion and deletion) 
dna sequences can arrange differently than they normally do (expression)
or there may be simple errors at single/multiple points of the sequence (point/frame shift)

None of these examples are new added information!

Down's syndrome happens due to an added copy of a chromosome. Its not new data. Its redundant.
The other examples are not useful new data. Its corrupted garbage.

any of these occurring in an organism can make drastic changes (but not necessarily so). some of these changes may be beneficial, some detrimental, some neutral. how these changes affect the organisms ability to survive and reproduce determines whether the mutation will be passed on. 

this is the driving force behind evolution.

None of these DNA changes you describe ever result in beneficial evolution.

no? genetic mutation in staph bacteria allowed it to become resistant to the antibiotics we used to use to kill it. we started using different antibiotics...which worked for a while until another mutation occurred that allowed the new strain to survive....and so on an so on....new strains of bacteria forming that are resistant to the drugs and sterilization agents we use to kill their predecessors.


how do you think new strains of antibiotic resistant bacteria occur? 

mutations through natural selection drive evolution.

[foggyb]

Does it matter WHAT corrupts the process, as long as it is corrupt/changed? Not all corruptions end up being bad.

Yes. If the DNA replicator is perfect, there far, far fewer opportunities for corruption.

Does it matter how many cells mutate? As long as one can, and does during reproduction, mutation is going on.

Yes it matters, if you are trying to prove evolution by the scientific method. The more mutations you have, the more opportunity for changes.

that some people are naturally more thin and muscle toned while others are more fat... That's pretty much all that's needed for evolution.

Some people are more thin, others are more fat, so evolution must be true. Hmm. I never thought of that.

As for the rest, your posts just make it seem as if you're REALLY trying hard to convince yourself otherwise.

You wish. I'm compensating for the stupid ideas people throw around that have no basis in reality. Just so there is no mistake: Evolution is a tidal wave of horseshit.

[foggyb]

genetic mutation in staph bacteria allowed it to become resistant to the antibiotics we used to use to kill it.

how do you think new strains of antibiotic resistant bacteria occur? jesus?

A small percentage of the staph are naturally resistant to any antibiotic, especially in lower doses. Because doctors prescribed low doses of antibiotics, and/or patients often do not complete their full rounds of antibiotics, the resistant staph survive and thrive.

It really is that simple. No horseshit magic required.

[myrkul]

genetic mutation in staph bacteria allowed it to become resistant to the antibiotics we used to use to kill it.

how do you think new strains of antibiotic resistant bacteria occur? jesus?

A small percentage of the staph are naturally resistant to any antibiotic, especially in lower doses. Because doctors prescribed low doses of antibiotics, and/or patients often do not complete their full rounds of antibiotics, the resistant staph survive and thrive.

So you accept Evolution finally? Because that is EXACTLY the mechanism. Genetic variation produces small portions of the population which will do better than the rest when exposed to negative environmental factors. Thank you, we're done here.

[evolve]

A small percentage of the staph are naturally resistant to any antibiotic,

any antibiotic? you believe this?

bullshit. you are going to have to back that one up.

 there is no population of staph that is inherently resistant to ALL antibiotics. resistance comes from mutation and natural selection.

[Rassah]

genetic mutation in staph bacteria allowed it to become resistant to the antibiotics we used to use to kill it.

how do you think new strains of antibiotic resistant bacteria occur? jesus?

A small percentage of the staph are naturally resistant to any antibiotic, especially in lower doses. Because doctors prescribed low doses of antibiotics, and/or patients often do not complete their full rounds of antibiotics, the resistant staph survive and thrive.

It really is that simple. No horseshit magic required.

You're claiming that for every conceivable type of antibiotic we have or may be able to think of up, there is already a staph bacteria in existence that is immune to it?

And I agree, you "don't think of that" when it comes to evolution. All you see is "some are thin, some are fat." You don't bother to take that out further and think about what may happen if the planet suddenly becomes more cold (ice age), where the thin ones may die out, or if the population is stuck on an island full of fast predators (fat ones will be chased down and eaten). It's a EXCELLENT argument against evolution to just focus on small individual parts and poke them one by one, while ignoring how they all work together. However, it's about as valid as saying that the computer you are typing replies on doesn't work, because hat single capacitor on your motherboard is't capable of processing binary data. Keep looking at the trees, ignoring the forest, ans staying ignorant. You're not convincing anyone but yourself.

[foggyb]

So you accept Evolution finally? Because that is EXACTLY the mechanism. Genetic variation produces small portions of the population which will do better than the rest when exposed to negative environmental factors. Thank you, we're done here.

Evolution is a slow gradual process, taking billions of years. * **

*EXCEPT FOR STAPH BACTERIA.
** EXCEPT WHEN ITS NOT

[foggyb]

A small percentage of the staph are naturally resistant to any antibiotic,

any antibiotic? you believe this?

bullshit. you are going to have to back that one up.

 there is no population of staph that is inherently resistant to ALL antibiotics. resistance comes from mutation and natural selection.

http://cid.oxfordjournals.org/content/45/Supplement_2/S129.full

Search for the phrase: "A subpopulation of resistant bacteria often exists"

[Rassah]

So you accept Evolution finally? Because that is EXACTLY the mechanism. Genetic variation produces small portions of the population which will do better than the rest when exposed to negative environmental factors. Thank you, we're done here.

Evolution is a slow gradual process, taking billions of years. * **

*EXCEPT FOR STAPH BACTERIA.
** EXCEPT WHEN ITS NOT

Again, you claim evolution is bunk, while showing that it's not true. Evolution doesn't take "billions of years," it takes "thousands of reproductive cycles." If something reproduces once every few decades, like mammals, evolution takes centuries, if not thousands or millions of years. If something reproduces every few days, like bugs/insects, it takes months or years. If something reproduces every few minutes or seconds, like bacteria, evolution can happen in days or hours.
For someone so uninformed, I would expect you to take a "I don't understand it, so I don't know if it's true or not" position, not "It's wrong!"
But, I guess religion does make the mind lazy.

[evolve]

So you accept Evolution finally? Because that is EXACTLY the mechanism. Genetic variation produces small portions of the population which will do better than the rest when exposed to negative environmental factors. Thank you, we're done here.

Evolution is a slow gradual process, taking billions of years. * **

*EXCEPT FOR STAPH BACTERIA.
** EXCEPT WHEN ITS NOT

yes the changing of an organism on a small scale can occur quick (particularly in simple organisms). but larger scale changes like that from a single cell creature to a multicell creature takes much more time. its take millions of years to get to this point, but many small changes occur constantly.

[evolve]

A small percentage of the staph are naturally resistant to any antibiotic,

any antibiotic? you believe this?

bullshit. you are going to have to back that one up.

 there is no population of staph that is inherently resistant to ALL antibiotics. resistance comes from mutation and natural selection.

http://cid.oxfordjournals.org/content/45/Supplement_2/S129.full

did you even attempt to read it?   



"The fact that the choice of dose and treatment duration can affect the selection of antibiotic-resistant mutants is becoming more evident" 

[Rassah]

A small percentage of the staph are naturally resistant to any antibiotic,

any antibiotic? you believe this?

bullshit. you are going to have to back that one up.

 there is no population of staph that is inherently resistant to ALL antibiotics. resistance comes from mutation and natural selection.

http://cid.oxfordjournals.org/content/45/Supplement_2/S129.full

Note the heavy use of the words "mutant," "mutated," and "developed" in that article. Thanks for proving our point.

[foggyb]

Note the heavy use of the words "mutant," "mutated," and "developed" in that article. Thanks for proving our point.

You clearly didn't.

"A subpopulation of resistant bacteria often exists. "

[myrkul]

So you accept Evolution finally? Because that is EXACTLY the mechanism. Genetic variation produces small portions of the population which will do better than the rest when exposed to negative environmental factors. Thank you, we're done here.

Evolution is a slow gradual process, taking billions of years. * **

*EXCEPT FOR STAPH BACTERIA.
** EXCEPT WHEN ITS NOT

How fast does Staph reproduce?

How fast the Duck-billed Platypus?

How fast the Peppered Moth?

Despite your vaunted faith in the self-correction capabilities of DNA, it still fucks up, as evinced by the numerous genetic disorders that plague humanity.

Faith? You must be joking. Your body produces 10 trillion copies of your DNA daily just counting white blood cells. That replication code has to be friggin airtight.

Genetic disorders are the result of lost/scrambled information. That is not new information, its new garbage. Information comes only from intelligence. Randomness it the total absence of information.

And when it's not 'friggin airtight' we get cancer. Or a mutation.

And sometimes, that 'new garbage' turns out to be helpful.

https://secure.wikimedia.org/wikipedia/en/wiki/Peppered_moth_evolution

I find it more telling that you completely ignored the 'breathing hole same as the drinking hole' and 'testicles danging unprotected' points, and instead, focused on the point you could refute, 'platypus is ugly'.

How does evolution adapt? Magic? Where is evolution? What is the source? If it is non-physical, how does it impact physical matter?

https://secure.wikimedia.org/wikipedia/en/wiki/Natural_selection

Quoted because you ignored it again.

Quoted because you ignored it yet again.

Quoted because you ignored it yet again.

PS: Please respond soon, I'm going to run out of styles.

[foggyb]

PS: Please respond soon, I'm going to run out of styles.

What are you, 7 years old?